1363 Loop készítése
Megosztás bekapcsolva
Megosztás kikapcsolva
0
0
1 hete

Forrás:

A TechChrunch cikke: Malicious Code Written into DNA Infects the Computer that Reads It

Az eredeti tanulmány:PDF

Varga Máté cikke: A DNS a jövő adathordozója?

UPDATE! Mialatt vágtam, Máténak élesült a cikke ebben a témában is: Így fertőzhetné meg a DNS a számítógéped

ACTGACTGACTGACTGACTGACTGACTGACT

A hivatkozott podcast adások:
Az ember a zebrahal mögött
Így hekkelj atomprogramot, avagy a kiberháború frontvonalai

ACTGACTGACTGACTGACTGACTGACTGACT

Technikai infók:

Kamera: Canon EOS M6
Mikrofon: Rode VideoMic Pro

ACTGACTGACTGACTGACTGACTGACTGACT

Itt találsz meg...
...Facebookon
...Youtube-on
...Instagramon
...Twitteren
...Tumblr-ön

Mutat
0
0
0
0
Méret:pxpx

Videó jelentése.

Mi a probléma?

  • Szexuális tartalom
  • Erőszakos tartalom
  • Sértő tartalom
  • Gyermekbántalmazás
  • Szerzői jogaimat sértő tartalom
  • Egyéb jogaimat sértő tartalom (pl.képmásommal való visszaélés)
  • Szexuális visszaélés, zaklatás

Kérjük, add meg e-mail címed, ahol fel tudjuk venni veled a kapcsolatot.

...
Jelentésed rögzítettük. Hamarosan intézkedünk.
A hozzászólások le vannak tiltva ennél a videónál
Felhasználó videói
1 | 2 | 3 | 4
következő
Válassz felhasználónevet!

Ezen a néven jelennek majd meg a videóid és a kommentjeid.

Felhasználónév:
Mehet

Ezzel elfogadod az Indavideó felhasználási feltételeit.

Felhasználódat regisztráltuk!
Felhasználódat regisztráltuk, szánj néhány percet a profilod Beállítására, amit a Beállítások menüpont alatt tudsz megtenni!

Hozzászóláshoz lépj be az Indapassoddal!

VAGY

Megerősítés!